Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7)

Main Article Content

I Wayan Suardana I Nengah Sujaya Wayan Tunas Artama

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.

Downloads

Download data is not yet available.

Article Details

How to Cite
SUARDANA, I Wayan; SUJAYA, I Nengah; ARTAMA, Wayan Tunas. Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7). Jurnal Veteriner, [S.l.], v. 13, n. 4, p. 434-439, july 2013. ISSN 2477-5665. Available at: <https://ojs.unud.ac.id/index.php/jvet/article/view/6036>. Date accessed: 09 aug. 2022.
Keywords
E.coli O157:H7, Shiga like toxin, PS2 probe
Section
Articles

Most read articles by the same author(s)

1 2 > >>