DESAIN PELACAR DNA SECARA IN SILICO SEBAGAI PENDETEKSI RESISTENSI FLUOROQUINOLONE PADA ISOLAT MULTI DRUG RESISTANT TUBERCULOSIS

  • Sagung Chandra Yowani Kelompok Studi MDR-TB & XDR-TB, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361
  • Jennifer Tamara Program Studi Farmasi, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361
  • Ayu Nyoman Chandra Yustiana Program Studi Farmasi, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361
  • Putu Sanna Yustiantara Kelompok Studi MDR-TB & XDR-TB, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361

Abstract

ABSTRAK: Resistensi fluoroquinolone (FQ) pada Multi Drug Resistant Tuberculosis (MDR-TB) umumnya disebabkan oleh adanya sejumlah mutasi pada beberapa gen yang mengkode sensitivitas Mycobacterium tuberculosis dan sebagian besar terjadi pada gen gyrA. Mutasi pada kodon 94 gen gyrA merupakan mutasi yang paling sering terjadi dengan 7 variasi perubahan asam amino. Resistensi FQ dapat dideteksi menggunakan DNA probe yang spesifik agar dapat memberi terapi yang tepat pada pasien. Penelitian ini akan mendesain urutan nukleotida TaqMan probe menggunakan program Clone Manager Suite 9.2. Hasil rancangan DNA probe kemudian dianalisis dalam 2 tahap. Tahap pertama berdasarkan kriteria probe secara umum yaitu panjang (18-30 basa), %GC (40-60%), Tm (5-10°C lebih tinggi dibanding Tm primer), runs (? 4), repeats (? 4), dimer (? 4), dan tidak terbentuk hairpin. Selanjutnya tahap kedua berdasarkan kriteria pelabelan TaqMan probe, yaitu tidak terdapat basa G pada 2 nukleotida di ujung 5’ dan jumlah basa C ? G. Rancangan DNA probe mutan menggunakan program menghasilkan 1 probe untuk mutasi spesifik D94G. Probe tersebut dianalisa dengan kriteria probe secara umum dan kriteria pelabelan TaqMan probe. Kesimpulan dari penelitian ini yaitu hasil rancangan probe mutan A94MG1 dengan urutan 5’ – TCGATCTACGGCAGCCTGGT – 3’ telah memenuhi kriteria pelabelan TaqMan probe dan dapat digunakan untuk mendeteksi adanya mutasi pada kodon 94 gen gyrA Mycobacterium tuberculosis.


Kata kunci: MDR-TB, gen gyrA, in silico, TaqMan probe, Real-Time PCR


ABSTRACT: Fluoroquinolone (FQ) resistance in Multi Drug Resistant Tuberculosis (MDR-TB is generally caused by some mutations in several genes that encode the sensitivity of Mycobacterium tuberculosis and most of them occur in gyrA gene. Mutations in codon 94 gyrA gene are the most common mutations with 7 variations in amino acid changes. FQ resistance can be detected using a spesific DNA probe to provide the precise therapy for the patient. This research will design the TaqMan probe nucleotide sequence using the Clone Manager Suite 9.2.  program. The results of designing DNA probes were then analyzed by 2 stages. The first stage is based on criteria of the probe in general which is length (18-30 bases), GC% (40-60%), Tm (5-10°C higher than primer Tm), runs (? 4), repeats (? 4), dimer (? 4), and hairpin is not formed. Second stage is examination based on the labeling criteria for TaqMan, that is no G base at 2 nucleotides at the end of 5’ and the amount of bases C ? G. The mutant DNA probe design using the program produced 1 probe for the D94G specific mutation. The probe was analyzed with general criteria and TaqMan probe labeling. The conclusion of this study is A94MG1 mutant probe design have met the TaqMan probe labeling criteria and can be used to detect mutations in the Mycobacterium tuberculosis gyrA gene codon 94.

Downloads

Download data is not yet available.

References

[1] World Health Organization. 2018, Global Tuberculosis Report 2018, Perancis: World Health Organization.
[2] Malik, S., Willby, M., Sikes, D., Tsodikov, O. V. and Posey, J. E. 2012, New Insights into Fluoroquinolone Resistance in Mycobacterium tuberculosis: Functional Genetic Analysis of gyrA and gyrB Mutations, Plos One, 7: 1-10.
[3] Rinanda, T. 2015, Kajian Molekuler Mekanisme Resistensi Mycobacterium tuberculosis, Jurnal Kedokteran Syiah Kuala, 15: 162-167.
[4] Maruri, F., Sterlin, T. R., Kaiga, A. W., Blackman, A., Heijden, Y. F., Mayer, C., et al. 2012, A systematic review of gyrase mutations associatef with fluoroquinolone-resistant Mycobacterium tuberculosis and a proposed gyrase numbering system, Journal of Antimicrobiology Chemotherapy, 67: 819-831.
[5] Disratthakit, A., Prammananan, T., Tribuddharat, C., Thaipisuttikul, I., Doi, N., Leechawengwongs, M., et al. 2016, Role of gyrB Mutations in Pre-extensively and Extensively Drug-Resistant Tuberculosis in Thai Clinical Isolates, Antimicrobial Agents and Chemotherapy, 60: 5189-5197.
[6] Zhang, Z., Lu, J., Wang, Y., Pang, Y., and Zhao, Y. 2014, Prevalence and Molecular Characterization of Fluoroquinolone-Resistant Mycobacterium tuberculosis Isolates in China, Antimicrobial Agents and Chemotherapy, 58: 364-369.
[7] Da Silva, P. E. A. and Palomino, J. C. 2011, Molecular basis and mechanisms of drug resistance in Mycobacterium tuberculosis: classical and new drugs, Journal of Antimicrobiology Chemotherapy, 66: 1417-1430.
[8] Li, J., Gao, X., Luo, T., Wu, J., Sun, G., Liu, G., et al. 2014, Association of gyrA/B mutations and resistance levels to fluoroquinolones in clinical isolates of Mycobacterium tuberculosis, Emerging Microbes and Infections, 3: 1-5.
[9] Avalos, E., Catanzaro, D., Catanzaro, A., Ganiats, T., Brodine, S., Alcaraz, J., et al. 2015, Frequency and Geographic Distribution of gyrA and gyrB Mutations Associated with Fluoroquinolone Resistance in Clinical Mycobacterium tuberculosis Isolates: A Systematic Review, Plos One, 10: 1-24.
[10] Yin, X. and Yu, Z. 2010, Mutation characterization of gyrA and gyrB genes in levofloxacin-resistant Mycobacterium tuberculosis clinical isolates from Guangdong Province in China, Journal of Infection, 61: 150-154.
[11] Cui, Z., Wang, J., Lu, J., Huang, X., and Hu, Z. 2011, Association of mutation patterns in gyrA/B genes and ofloxacin resistance levels in Mycobacterium tuberculosis isolates from East China in 2009, BMC Infections Diseases, 11: 1-5.
[12] Walker, J. M. and Rapley, R. 2005, Medical Biomethods Handbook, Humana Press Inc., New Jersey.
[13] McPherson, M. J. and Moller, S. G. 2006, PCR Second Edition, Taylor & Francis Group, New York.
[14] Navarro, E., Serrano-Heras, G., Castano, M. J., and Solera, J. 2015, Real-time PCR detection chemistry, Clinica Chimica Acta, 439: 231-250.
[15] Chou, C., Chen, C., Lee, T., and Peck, K. 2004, Optimization of probe length and the number of probes per gene for optimal microarray analysis of gene expression, Nucleic Acids Research, 32: 1-8.
[16] Sasmitha, L. V. 2017, Eksplorasi Mutasi Gen gyrA Sebagai Penanda Extensively Drugs Resistant Tuberculosis pada Isolat Klinik Multidrug-Resistant Tuberculosis di Bali dengan Metode Polymerase Chain Reaction, Skripsi, Program Studi Farmasi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana.
[17] Anonim a. 2006, Real-Time PCR Applications Guide. Bulletin 5279, Bio-Rad Laboratories Inc., USA. Available At: http://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_5279.pdf
[18] Pebriani, N. N. 2019, Desain DNA Probe secara In Silico Sebagai Pendeteksi Mutasi Gen gyrA dan gyrB Mycobacterium tuberculosis untuk Metode Real Time Polymerase Chain Reaction, Skripsi, Program Studi Farmasi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Udayana.
[19] Anonim b. 2001, Allelic Discrimination Using The 5’ Nuclease Assay, Applied Biosystems, USA, Available At: http://www.austincc.edu/mlt/mdfund/mdfund_Unit11AllelicDiscrimination.pdf
[20] Alvandi, E. and Koohdani, F. 2014, Zip Nucleic Acid: A New Reliable Method To Increase The Melting Temperature of Real-Time PCR Probes, Journal of Diabetes & Metabolic Disorders, 13: 1-4.
[21] Rodriguez, A., Rodriguez, M., Cordoba, J. J., and Andrade, M. J. 2015, ‘Design of Primers and Probes for Quantitative Real-Time PCR Methods’ in Basu, C., PCR Primer Design, 2nd ed, Humana Press, New York, pp. 31-53.
[22] Narayanan, S. 1992, Overview of Principles and Current uses of DNA Probes in Clinical and Laboratory Medicine, Annals of Clinical and Laboratory Science, 22: 353-376.
[23] Borah, P. 2011, Primer Designing for PCR, Science Vision, 11: 134-136.
[24] Patel, N. K., and Prakash, N. 2013, Principle and Tools For Primer Design, Atmiya Spandan Biological Sciences, 1: 79-95.
[25] Meuer, S. C., Wittwer, and Nakagawara, K. 2001, Rapid Cycle Real-Time PCR: Method and Applications, Springer, Berlin.
[26] Bishop, J. L., Campbell, S. A., Farrell, P., Fitzgerald, M., Haugen, M., Kocmond, W., Madden, D. E., Murray, W. E., and Persing, D. H. 2015, Designing Real Time Assays on the SmartCycler® II System, Cepheid Technical Support, United States, pp 1-8, Available At: http://www.cepheid.com/en/component/phocadownload/category/5-support?download=87:smart-note-6-1
[27] Rychlik, W. 2010, OLIGO Primer Analysis Software Version 7, Molecular Biology Insights, Inc., USA.
[28] Yuwono, T. 2008, Biologi Molekuler, Penerbit Erlangga, Jakarta. pp. 49-74
[29] Dorak, M. T. 2007, Real-Time PCR, Taylor and Francis Group, New York.
[30] Arya, M., Shergill, I. S., Williamson, M., Gommersall, L., Arya, N., and Patel, H. R. H. 2005, Basic principles of real-time quantitative PCR, Experts Rev. Mol. Diagn., 5: 209-219.
[31] Rodriguez-Lazaro, D. and Hernandez, M. 2013, Real-Time PCR in Food Science: Introduction, Curr. Issues Mol. Biol., 15: 25-38.
[32] Murray, J. L., Hu, P., and Shafer, D. A. 2014, Seven Novel Probe Systems for Real-Time PCR Provide Absolute Single-Base Discrimination, Higher Signaling, and Generic Components, The Journal of Molecular Diagnostics, 16: 627-628.
[33] Seifi, M., Ghasemi, A., Heidarzadeh, S., Khosravi, M., Namipashaki, A., Soofiany, V. M., et al. 2012, ‘Overiew of Real-Time PCR Principles’ in Hernandez-Rodriguez, P., Polymerase Chain Reaction, InTechOpen, London.
[34] Proudnikov, D., Yuferov, V., Zhou, Y., LaForge, K. S., Ho, A., and Kreek, M. J. 2003, Optimizing primer-probe design for fluorescent PCR, Journal of Neuroscience Methods, 123: 31-45.
Published
2019-10-31
How to Cite
YOWANI, Sagung Chandra et al. DESAIN PELACAR DNA SECARA IN SILICO SEBAGAI PENDETEKSI RESISTENSI FLUOROQUINOLONE PADA ISOLAT MULTI DRUG RESISTANT TUBERCULOSIS. CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry), [S.l.], v. 7, n. 2, p. 112-121, oct. 2019. ISSN 2302-7274. Available at: <https://ojs.unud.ac.id/index.php/cakra/article/view/56183>. Date accessed: 25 sep. 2026.