DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION

  • Luk Ketut Budi Maitriani Jurusan Farmasi, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361
  • I Nengah Wirajana Jurusan Kimia, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361
  • Sagung Chandra Yowani 1. Jurusan Farmasi, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361 2. Kelompok Studi MDR-TB & XDR-TB, FMIPA, Universitas Udayana, Bukit Jimbaran, Bali-Indonesia, 80361

Abstract

ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen). Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB) mencakup kodon 94 (nukleotida 280-282). Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077). Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR). Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit) serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen), meliputi: panjang primer, %GC, Tm (melting temperature), interaksi primer (dimers dan hairpins), stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA) 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.

 

ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen). The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB) clinical isolates include codon 94 (nucleotide 280-282). Codon 94 of inhA gene is frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077). Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes) with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen) such as: primer length, %GC, Tm (melting temperature), primers interaction (dimers and hairpins), stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA) 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA) 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp.

ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS) at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

 

Downloads

Download data is not yet available.

References

[1] European Lung Foundation (ELF), Mutidrug-Resistant Tuberculosis (MDR-TB). Report, 2009

[2] World Health Organization (WHO), Global Tuberculosis Report 2014. Global Report, 2014.

[3] Valvatne, H., H. Syre, M. Kross, R. Stavrum, Ti Ti, S. Phyu and H. M. S. Grewal, Isoniazid and rifampicin resistance-associated mutations in Mycobacterium tuberculosis isolates from Yangon, Myanmar: implications for rapid molecular testing. Journal of Antimicrobial Chemotherapy, 2009, 64: 694–701

[4] Handoyo, D. dan A. Rudiretna, , Prinsip Umum Dan Pelaksanaan Polymerase Chain Reaction (PCR) (General Principles and Implementation Of Polymerase Chain Reaction). Unitas., 2000, 9 (1): 17-29

[5] Zador, E., , The Polymerase Chain Reaction. PCR Lectures, 2011

[6] Henegariu, O., N. A. Heerema, S. R. Dlouhy, G. H. Vancee and P. H. Vogt, , Multiplex PCR: Critical by Step Protocol. BioTechniques., 1997, 23: 504-511

[7] Borah, P., 2011, Primer Designing for PCR. Science Vision., vol. 11(3): 134-136

[8] Bartlett, J. M. S. dan Stirling, D., Methods in Molecular Biology. Vol. 226 : PCR Protocols 2nd Editions. Totowa, NJ : Human Press Inc. 2003: 81-604

[9] Yuryev, A., PCR Primer Design. Santalucia : Humana Press, 21-22

[10] Judelson, H., Guidelines For Designing Primers. Primer Guidelines., 2006, 10 (6): 1-5

[11] Premier Biosoft International (PBI), Net Primer Manual. 2009
Published
2015-10-28
How to Cite
MAITRIANI, Luk Ketut Budi; WIRAJANA, I Nengah; YOWANI, Sagung Chandra. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB) DENGAN METODE POLYMERASE CHAIN REACTION. CAKRA KIMIA (Indonesian E-Journal of Applied Chemistry), [S.l.], v. 3, n. 3, p. 89-95, oct. 2015. ISSN 2302-7274. Available at: <https://ojs.unud.ac.id/index.php/cakra/article/view/20287>. Date accessed: 20 july 2026.
Section
Articles

Keywords

Clone Manager Suite 6; primer design; inhA gene; MDR-TB; Polymerase Chain Reaction